View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9775_low_3 (Length: 462)
Name: NF9775_low_3
Description: NF9775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9775_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 29631411 - 29631603
Alignment:
| Q |
19 |
aaatagccaaaagtgactatgttcagtttttatttataattttaaaattgtcattgttttcagtccccgactgtagaactctgtgaaatggattctaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29631411 |
aaatagccaaaagtgactatgttcagtttttatttataattttaaaattgtcattgttttcagtccccgactgtagaactctgtgaaatggattctaaac |
29631510 |
T |
|
| Q |
119 |
ctggcagccgcacatggatttctcccataaccagtgagtcgcactctctcctttccctttcttccttcctggtcaaccgtaacagcttacttc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29631511 |
ctggcagccgcacatggatttctcccataaccagtgagtcgcactctctcctttccctttcttccttcctggtcaaccgtaacagcttacttc |
29631603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 247 - 446
Target Start/End: Original strand, 29631638 - 29631837
Alignment:
| Q |
247 |
ctcagcagctagctattgcaatacaacggactgtgataacgctggaaacgacaaacacacgtcgttttcagatctcggactctcggaatggatggtgcgg |
346 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29631638 |
ctcagcagctagctattgtaatacaacggactgtgataacgctggaaacgacaaacacatgtcgttttcagatctaggactctcggaatggatggtgcgg |
29631737 |
T |
|
| Q |
347 |
ggttgcgataaactcgggatgcaatctcctcggcccgtgcaacgacactgcattccaaaggttctagaaggccgtcatgtaattggaattgataaaactg |
446 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29631738 |
ggttgcgataaactcgggatgcaatctccgcggcccgtgcaacgacactgcattccaaaggttctagaaggccgtcatgtaattggaattgataaaactg |
29631837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 435
Target Start/End: Original strand, 29630583 - 29630707
Alignment:
| Q |
311 |
ttttcagatctcggactctcggaatggatggtgcggggttgcgataaactcgggatgcaatctcctcggcccgtgcaacgacactgcattccaaaggttc |
410 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||| | |||| | || |||||||||||| | || |||| |||||||| |||||||||||| ||||||| |
|
|
| T |
29630583 |
ttttccgatctcggactctcggaatggacggtgcagaattgcaagaagctcgggatgcaaacaccgcggcgcgtgcaacaacactgcattcctaaggttc |
29630682 |
T |
|
| Q |
411 |
tagaaggccgtcatgtaattggaat |
435 |
Q |
| |
|
||||||||||| |||| ||||||| |
|
|
| T |
29630683 |
tagaaggccgtgatgtggttggaat |
29630707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 310 - 343
Target Start/End: Complemental strand, 28390281 - 28390248
Alignment:
| Q |
310 |
gttttcagatctcggactctcggaatggatggtg |
343 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
28390281 |
gttttcagatctcggactctcagaatggatggtg |
28390248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University