View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9776_low_4 (Length: 296)

Name: NF9776_low_4
Description: NF9776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9776_low_4
NF9776_low_4
[»] chr1 (1 HSPs)
chr1 (86-277)||(19643899-19644090)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 86 - 277
Target Start/End: Complemental strand, 19644090 - 19643899
Alignment:
86 aatggcaaatatatataaagaagatacggaagatacaatgtacaaaggatgaaaatgattgtctaatggacaaaattagacaatgaatttgaaggaaaaa 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19644090 aatggcaaatatatataaagaagatacggaagatacaatgtacaaaggatgaaaatgattgtctaatggacaaaattagacaatgaatttgaaggaaaaa 19643991  T
186 tgataatatgaaaggttagcaacaatgaacaaacagtaaatagatatatttgttatggcctttgcaagaatagtaaacaaacccgttgattt 277  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19643990 taataatatgaaaggttagcaacaatgaacaaacagtaaatagatatatttgttatggcctttgcaagaatagtaaacaaacccgttgattt 19643899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University