View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9776_low_4 (Length: 296)
Name: NF9776_low_4
Description: NF9776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9776_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 86 - 277
Target Start/End: Complemental strand, 19644090 - 19643899
Alignment:
| Q |
86 |
aatggcaaatatatataaagaagatacggaagatacaatgtacaaaggatgaaaatgattgtctaatggacaaaattagacaatgaatttgaaggaaaaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19644090 |
aatggcaaatatatataaagaagatacggaagatacaatgtacaaaggatgaaaatgattgtctaatggacaaaattagacaatgaatttgaaggaaaaa |
19643991 |
T |
 |
| Q |
186 |
tgataatatgaaaggttagcaacaatgaacaaacagtaaatagatatatttgttatggcctttgcaagaatagtaaacaaacccgttgattt |
277 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19643990 |
taataatatgaaaggttagcaacaatgaacaaacagtaaatagatatatttgttatggcctttgcaagaatagtaaacaaacccgttgattt |
19643899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University