View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9776_low_6 (Length: 261)
Name: NF9776_low_6
Description: NF9776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9776_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 246
Target Start/End: Original strand, 43303467 - 43303693
Alignment:
| Q |
20 |
gaagggtcatgtgaaagaggtcgtacttcaaaggtttagtatgccaaagaaaatgtttctgaactcttctgacaccaagttgtagcttgagatacttctc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43303467 |
gaagggtcatgtgaaagaggtcgtacttcaaaggtttagtatgccaaagaaaatgtttctgaactcttctgacaccaagttgtagcttgagatacttctc |
43303566 |
T |
|
| Q |
120 |
ttcaggcactgaaagaagtatttgtttcaagtttggaatatctttctctgcaaggattaatgagaatgcatcccaatttaaaacctcaaaatatggcggc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
43303567 |
ttcaggcactgaaagaagtatttgtttcaagtttggaatatctttctctgcaaggattaatgagaatgaatcccaatttaaaacctcaaaaaatggcggc |
43303666 |
T |
|
| Q |
220 |
acaaaattgtcagatatgatcacaggt |
246 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43303667 |
acaaaattgtcagatatgatcacaggt |
43303693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University