View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9776_low_8 (Length: 246)
Name: NF9776_low_8
Description: NF9776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9776_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 26031537 - 26031761
Alignment:
| Q |
1 |
gtgtcattcccaaatcaaccaacccaaataggatcaaagagaatgtggttgtcttcaattgggaacttccagataatgacttcaacaaacttagcaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031537 |
gtgtcattcccaaatcaaccaacccaaataggatcaaagagaatgtggttgtcttcaattgggaacttccagataatgacttcaacaaacttagcaaaat |
26031636 |
T |
|
| Q |
101 |
accagatcaggtagctcacaagcatgggtcgaaatagtttccgatttgataaatagatctttaaaattgttaatttcatccaaaatggtccatccgttga |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031637 |
accagatcaggtagctcacaagcattggtcgaaatag-ttccgatttgataaatagatctttaaaattgttaatttcatccaaaatggtccatccgttga |
26031735 |
T |
|
| Q |
201 |
cttctactattggagctatgatgtgg |
226 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
26031736 |
cttctactattggagctatgacgtgg |
26031761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University