View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9777_high_8 (Length: 233)
Name: NF9777_high_8
Description: NF9777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9777_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 217
Target Start/End: Complemental strand, 39064877 - 39064681
Alignment:
| Q |
21 |
gaaggaacatcaagatcattgaaaggaaaacatatagctggtgaaataatgtttgaattccctgaaatgatggtttgccatgcagattcattctttatag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39064877 |
gaaggaacatcaagatcattgaaaggaaaacatatagctggtgaaataatgtttgaattccctgaaatgatggtttgccatgcagattcattctttatag |
39064778 |
T |
 |
| Q |
121 |
gacatccaattccagttttatccatagatgatgaacttatgttaggtcaaacctactttgttctacctattgaccgttttgctattgacaccctctc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39064777 |
gacatccaattccagttttatccatagatgatgaacttatgttaggtcaaacctactttgttctacctattgaccgttttgctattgacaccctctc |
39064681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University