View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9778_high_20 (Length: 379)

Name: NF9778_high_20
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9778_high_20
NF9778_high_20
[»] chr2 (1 HSPs)
chr2 (317-372)||(14185247-14185302)


Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 317 - 372
Target Start/End: Original strand, 14185247 - 14185302
Alignment:
317 aatataattttatctctcttgatgcatgtaggcgaaacatagaagttttgtctctg 372  Q
    |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||    
14185247 aatacaattttatctctcttgatgtatgtaggcgaaacatagaagttttgtctctg 14185302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University