View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_high_38 (Length: 262)
Name: NF9778_high_38
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 35 - 248
Target Start/End: Complemental strand, 38213405 - 38213192
Alignment:
| Q |
35 |
gttaggaggagatttttaaagnnnnnnnncctgtaagttctcgccagtttcttcaatacagcaaatgtgagttcctttaattatgctttgattcttaaat |
134 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38213405 |
gttaggaggagattttgaaagaaaaaaaacctgtaagttctcgccagtttcttcaatccagcaaatgtgagttcctttaattatgctttgattcttaaat |
38213306 |
T |
 |
| Q |
135 |
aagagtaagaatttggtatgaatcttgaatgaattggtaattatagttaagatgtagtgtggttgctataaatttgttttgggacttttagtaacataaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
38213305 |
aagagtaagaatttggtatgaatcttgaaggaattggtaattatagttaagatgtagtgtggttgatataaatttattttgggacttttagtaacataaa |
38213206 |
T |
 |
| Q |
235 |
caaggtgttgtttt |
248 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38213205 |
caaggtgttgtttt |
38213192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University