View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_high_46 (Length: 250)
Name: NF9778_high_46
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 10521823 - 10522059
Alignment:
| Q |
1 |
atggttttagtatgagattttaccaacatcttttaaaaatttatgaagtattgacatttttctaagagttgccttaatacaagtttctttcagaaaccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
10521823 |
atggttttagtatgagattttaccaacatcttttaaaaatttatgaagtattgacatttttctaagagttgccttaatacaaattcctttcagacaccct |
10521922 |
T |
|
| Q |
101 |
aaatatgacaaacataacgctcatcctaaaggcgaattgtagaaacaagcgtgaaaattccaaatcaacctggatgcccttgcgtctcatttgattaagt |
200 |
Q |
| |
|
||||||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10521923 |
aaatatgacaaacataacgttcatcc---agacgaattgtagaaacaagcgtgaaaattccaaatcaacctggatgcccttgcgtctcatttgtttaagt |
10522019 |
T |
|
| Q |
201 |
aaaatattatccaaacaacaatttcttggcatcacctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10522020 |
caaatattatccaaacaacaatttcttggcatcacctatg |
10522059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University