View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9778_high_48 (Length: 245)

Name: NF9778_high_48
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9778_high_48
NF9778_high_48
[»] chr5 (1 HSPs)
chr5 (14-230)||(853013-853228)


Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 14 - 230
Target Start/End: Original strand, 853013 - 853228
Alignment:
14 agaacgaaaaatagtcattgagacttgatcttgagcgggtaaaaatggaaatggaagaaagagtaaccagccaaccagaaaccgcgaaggaagcaacagt 113  Q
    ||||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||    
853013 agaaccaaaaatagtcgttgagacttgatcttgagcgtgtaaaaatggaaatggaagaa-gagtaaccagccaaccagaaaccgcgaaggaagcaacggt 853111  T
114 tccatgaatgtcaacttgtttgacagtaactgggtgaagccatgtcacacaatggctaacggctgatttctcactgcatgaaattgcaaattaaaatgat 213  Q
    |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||| || ||||||||||||||||    
853112 tccatgaatgtcaacttgtttgacagcaactgggtgaagccatgtcatacaatggctaacggctgatttctcaccgcatgcaaatgcaaattaaaatgat 853211  T
214 caaaatcgaattatgtg 230  Q
    |||||||||||||||||    
853212 caaaatcgaattatgtg 853228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University