View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_high_61 (Length: 220)
Name: NF9778_high_61
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_high_61 |
 | |
|
| [»] scaffold0086 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0086 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 26111 - 25912
Alignment:
| Q |
1 |
gtaactatataaatatgatgaatttaattgaaaacacatcacaaacaacaacctgtgaagttgtgtattgtcagagttaacttgaacatagatatattac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26111 |
gtaactatataaatatgatgaatttaattgaaaacacatcacaaacaacaacttgttaagttgtgtattgtcagagttaacttgaacatagatatattat |
26012 |
T |
|
| Q |
101 |
tgatatttgaaatgtttaatttcagattagaaggttgagcaacatgtattctgagttgaaggaagaagaacaaagaaaatttggtgcaacttgcttcttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26011 |
tgatatttgaaatgtttaatttcagattagaaggttgagcaacatgtattctgagctgaaggaagaagaacaaagaaaatttggtgcaacttgcttcttc |
25912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University