View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_high_64 (Length: 218)
Name: NF9778_high_64
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_high_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 21778958 - 21779140
Alignment:
| Q |
16 |
atgaatagatttgcgaaactctatggagttagcatgattggaattgtaaatgtctgattcttcaaattcaaacatggtatctgaattcgttagagaagag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21778958 |
atgaatagatttgcgaaactctatggagttagcatgattggaattgtaaatgtctgattcttcaaattcaaacatggtatctgaatccgttagagaagag |
21779057 |
T |
|
| Q |
116 |
tctctatcaccagaaactgaaagaaagaggtggtttcttcttgcaaagtaacccttattgtttgccatgttggttttggaagttaaaat |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21779058 |
tctctatcacca------gaaagaaagaggtggtttcttcttgcaaagtaacccttattgtttgccatgttggttttggaagttaaaat |
21779140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University