View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_low_20 (Length: 414)
Name: NF9778_low_20
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 404
Target Start/End: Complemental strand, 13016052 - 13015656
Alignment:
| Q |
18 |
gaatggtgctgtttttggatctgcttaa----ggggtttgtgttgatctcgggcccctctgtggttggtgcagcttgttttgatcgtttcggttttagga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13016052 |
gaatggtgctgtttttggatctgcttaattaaggggtttgtgttgatctcgggcccctctgtggttggtgcagcttgttttgatcgtttcggttttagga |
13015953 |
T |
|
| Q |
114 |
tgggcctgtttgtatagattctttgggacctttccttttgctgtacttttctgcattaatcctttcttgctgctggttttgttcagtatgcatgggatgc |
213 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13015952 |
tgggtctgtttgtatagattctttggggcctttccttttgctgtacttttctgcattaatcctttcttgctgctggttttgttcagtatgcatgggatgc |
13015853 |
T |
|
| Q |
214 |
tagccttttagcactgctggtgcgtggcttttatacaagctgattc------nnnnnnnnnngacgccttgatcctagcattataacagtgggatttcag |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13015852 |
tagccttttagcactgctggtgcgtggcttttatataagctgattcaaaaaaaaaaaaaaatgacgccttgatcctagcattataacagtgggatttcaa |
13015753 |
T |
|
| Q |
308 |
cttgtgttttttcctctcgtgcatcaacttgcatattatgcgtttgtgcttctacttgtgaatccgtttatggctttatgcattcatacaacctatg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13015752 |
cttgtgttttttcctctcgtgcatcaacttgcatattatgcgtttgtgcttttacttgtgaatccgtttatggctttatgcattcatacaacctatg |
13015656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University