View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_low_52 (Length: 261)
Name: NF9778_low_52
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 13854291 - 13854540
Alignment:
| Q |
1 |
atgtttgcaccaccaccacaaaaaacacaattgaaattgttctccaaagggaagcaattcctccttgcaagattaactgtcgttggaataagtttgtgga |
100 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13854291 |
atgtttgcaccactaccacaaaacacacaattgaaactgttctccaaagggaagcaattcctccttgcaaggttaactgtcgttggaataagtttgtgga |
13854390 |
T |
 |
| Q |
101 |
gtaacttccnnnnnnnnnn------ccaccaccttggacgatattgaactcttccgaatcgtccgaaacaccgcctccttagaatcgcacaaagggccat |
194 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13854391 |
gtaacttccaaaaaaagaaaaaaaaccaccacctcggacgatattgaactcttccaaatcgtccgaaacaccgcctccttagaatggcacaaagggccat |
13854490 |
T |
 |
| Q |
195 |
ccacaatcaatatttcctcaagtaacttatatgctgacttcaccgagaac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13854491 |
ccacaatcaatatttcctcaagtaacttatatgccgacttcaccgagaac |
13854540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University