View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_low_64 (Length: 245)
Name: NF9778_low_64
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_low_64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 14 - 230
Target Start/End: Original strand, 853013 - 853228
Alignment:
| Q |
14 |
agaacgaaaaatagtcattgagacttgatcttgagcgggtaaaaatggaaatggaagaaagagtaaccagccaaccagaaaccgcgaaggaagcaacagt |
113 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
853013 |
agaaccaaaaatagtcgttgagacttgatcttgagcgtgtaaaaatggaaatggaagaa-gagtaaccagccaaccagaaaccgcgaaggaagcaacggt |
853111 |
T |
|
| Q |
114 |
tccatgaatgtcaacttgtttgacagtaactgggtgaagccatgtcacacaatggctaacggctgatttctcactgcatgaaattgcaaattaaaatgat |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
853112 |
tccatgaatgtcaacttgtttgacagcaactgggtgaagccatgtcatacaatggctaacggctgatttctcaccgcatgcaaatgcaaattaaaatgat |
853211 |
T |
|
| Q |
214 |
caaaatcgaattatgtg |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
853212 |
caaaatcgaattatgtg |
853228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University