View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_low_65 (Length: 243)
Name: NF9778_low_65
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_low_65 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 32863823 - 32863597
Alignment:
| Q |
1 |
gataatatactaagtatataaacaatgctaactacctaatgcaattaccagggtgtagagggctgttgggtcatttacgccaataatcacttggggttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32863823 |
gataatatactaagtatataaacaatgc-aactacctaatgcaattaccagggtgtagagggctgttgggtcatttacgccaataatcacttggggttga |
32863725 |
T |
|
| Q |
101 |
ttagcaacttgggaaggtttaagctcaccaccattggtaacagtcctattaccataggtgattaagagaggaatagtactttcaaaggggtctaatacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32863724 |
ttagcaacttgggaaggtttaagctcaccaccattggtaacagtcctattaccataggtgactaagagaggaatagtactttcaaaggggtctaatacat |
32863625 |
T |
|
| Q |
201 |
cccctattacacgcccaacagcaagagg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32863624 |
cccctattacacgcccaacagcaagagg |
32863597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 95 - 222
Target Start/End: Complemental strand, 32843741 - 32843614
Alignment:
| Q |
95 |
ggttgattagcaacttgggaaggtttaagctcaccaccattggtaacagtcctattaccataggtgattaagagaggaatagtactttcaaaggggtcta |
194 |
Q |
| |
|
|||||||| ||| ||| |||||||| ||||||| |||||| | ||| ||||||||||||||| | | |||||||| | | ||||||| | ||||| |
|
|
| T |
32843741 |
ggttgatttccaatttgagaaggtttgagctcacaaccattattcacatccctattaccataggtcactcgaagaggaatggaattttcaaatgagtcta |
32843642 |
T |
|
| Q |
195 |
atacatcccctattacacgcccaacagc |
222 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
32843641 |
ttacatcccctattacacgccctacagc |
32843614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University