View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_low_67 (Length: 242)
Name: NF9778_low_67
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_low_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 10521771 - 10521566
Alignment:
| Q |
18 |
tactatgaaaggaggtgtgaacttttcattatttgaagtaagaatagacgacattataacattacttataggatcacaagttcnnnnnnnnnnnnnnnnn |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10521771 |
tactatgaaaggaggtgtagacttttcattatttgaagta-gaatagacgacattataacattaattagaggatcacaagttcttttttttgtttctttt |
10521673 |
T |
 |
| Q |
118 |
ncgcaaacaatttgaaaaaagaataattagtcaaaatggtcacatagttaacttcagccgttatgagacaacatgttaaatgaacatgtggttttttatg |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| || | |
|
|
| T |
10521672 |
tggcaaacaattcgaaaaaagaataattagttaaaatggtcacatagttaacttcagccgttatgagacaaaatgttaaatgaacatgtgggtttctacg |
10521573 |
T |
 |
| Q |
218 |
tggatcc |
224 |
Q |
| |
|
||||||| |
|
|
| T |
10521572 |
tggatcc |
10521566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University