View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_low_69 (Length: 240)
Name: NF9778_low_69
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_low_69 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 6856376 - 6856598
Alignment:
| Q |
1 |
actatctggcgtggcagacttggatgcctttctannnnnnnatcaagaagtatttttgtttttgccacattataataaataaatatgaagcgttaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6856376 |
actatctggcgtggcagacttggatgcctttctatttttttatcaggaagtatttttgtttttgccacattataataaataaatatgaagcgttaattat |
6856475 |
T |
|
| Q |
101 |
tagttttttctctctacttttggtccagtaatctttctgcattataatattagcaaccctgcaacttgcaagcttctatggagaatcttatcattgaata |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6856476 |
tagttttttctgtctacttttggtccagtaatctttctgcattataatattagcaaccctgcaacttgcaagcttctatggagaatcttatcattgaata |
6856575 |
T |
|
| Q |
201 |
ttttgtattagtaggacggtaat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6856576 |
ttttgtattagtaggacggtaat |
6856598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University