View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_low_78 (Length: 233)
Name: NF9778_low_78
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_low_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 94 - 215
Target Start/End: Original strand, 41398493 - 41398615
Alignment:
| Q |
94 |
tatgatactta-caatttctaaggcctgtgtcggatcctcggtcaatgtcatggtgaaggcaactgctttgcgaaggcctaaggttccactatgccatgt |
192 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||| ||||||||| ||| || ||||| || | ||||||||||| |
|
|
| T |
41398493 |
tatgatacttaacaatttctaaggcctgtgttggatcctcagtcaatgtcatggtgtaggcaactgattttttttggtctaagctttcgctatgccatgt |
41398592 |
T |
|
| Q |
193 |
ggggaaagacggagggtagatct |
215 |
Q |
| |
|
|||||| ||||||||| |||||| |
|
|
| T |
41398593 |
ggggaatgacggagggaagatct |
41398615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 204
Target Start/End: Original strand, 12471836 - 12471870
Alignment:
| Q |
170 |
cctaaggttccactatgccatgtggggaaagacgg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12471836 |
cctaaggttccactatgccatgtggggaatgacgg |
12471870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University