View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9778_low_87 (Length: 220)
Name: NF9778_low_87
Description: NF9778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9778_low_87 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 28383171 - 28383306
Alignment:
| Q |
1 |
ttttcggttatagcagctgatgagaatatggtggaggtttcatttttaagatcatggacatcttcgatgagtggcaaagatgtccctataaacattgaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
28383171 |
ttttcggttatagcagctgatgagaatatggtggaggtttcatttttaagatcatggacatcttcaatgagtggcaaagatgtccctataaacatagaca |
28383270 |
T |
|
| Q |
101 |
aaaggtggattattcaatttcttatagttaaaatta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28383271 |
aaaggtggattattcaatttcttatagttaaaatta |
28383306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 28411905 - 28411792
Alignment:
| Q |
1 |
ttttcggttatagcagctgatgagaatatggtggaggtttcatttttaagatcatggacatcttcgatgagtggcaaagatgtccctataaacattgaca |
100 |
Q |
| |
|
||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||| || |||||||| || | |
|
|
| T |
28411905 |
ttttcagttatagtagctaatgagaatatggtggaggtttcatttttaagatcatggacatcttccatgactggcatagatgttcccataaacatcgata |
28411806 |
T |
|
| Q |
101 |
aaaggtggattatt |
114 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28411805 |
tcaggtggattatt |
28411792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 28391321 - 28391431
Alignment:
| Q |
1 |
ttttcggttatagcagctgatgagaatatggtggaggtttcatttttaagatcatggacatcttcgatgagtggcaaagatgtccctataaacattgaca |
100 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||| ||||| ||||||| ||| |||||||||||| ||||||| |||||||| || | |
|
|
| T |
28391321 |
ttttcagttattgcagctgatgagaatatggtggaggtttcattttcaagattatggacacattccatgagtggcaaaaatgtccccataaacatagata |
28391420 |
T |
|
| Q |
101 |
aaaggtggatt |
111 |
Q |
| |
|
|||||||||| |
|
|
| T |
28391421 |
taaggtggatt |
28391431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University