View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_high_21 (Length: 346)
Name: NF9779_high_21
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 54263949 - 54264277
Alignment:
| Q |
1 |
ttcaatctgctacggggttctgttatgcagagttcccatgttttgtcggcgcatcacacttgctcggacaactttggttgttttgtgttggaattctcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54263949 |
ttcaatctgctacggggttctgttatgcagaattcccgtgttttgttggcgcatcacacttgctcggacaactttggttgttttgtgttggaattctcat |
54264048 |
T |
|
| Q |
101 |
ctacagatgtggtaggctgagttttctagcaatgtgtggaagtttggcttgcaaaggtgtgatccgttgtttcctgcggagttgggttgcttgcatgcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54264049 |
ctacagatgtggtaggctgagttttctagcaatatgtgggagtttggcttgcaaaggtgtgatccgttgtttcctgcggagttgggttgcttgcatgcag |
54264148 |
T |
|
| Q |
201 |
agtggaagtggtggctaaagggatatcggtctgattgcttattggttttcattttgtggagggttgagtagtagtttgtgagggggtgggctttttgtcc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54264149 |
agtggaagtggtggctaaagggatatcggtctgattgctta-tggttttcattttgtggagggttgagtagtagtttgtgagggggtgggctttttgtcc |
54264247 |
T |
|
| Q |
301 |
tttgctgaggtgtatccttatgtatgttat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54264248 |
tttgctgaggtgtatccttatgtatgttat |
54264277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University