View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9779_high_35 (Length: 273)

Name: NF9779_high_35
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9779_high_35
NF9779_high_35
[»] chr2 (1 HSPs)
chr2 (15-259)||(2686244-2686488)


Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 259
Target Start/End: Original strand, 2686244 - 2686488
Alignment:
15 gatgaattgagaagtactatgtttccattgtcaccgattttgaggtgactattggttgaattttgaagagggttgtctctgtttgcgacccaaacaatcg 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |    
2686244 gatgaattgagaagtactatgtttccattgtcaccgattttgaggtgactattggttgaattttgaagagggttgtctctgtttgcgacccaaacaacag 2686343  T
115 tgtcttcgatgtttttgtaccatatggctaagtaaatgttgttggaatttgttccggggatgaaaccaagaacaaatgtttggttgggtgattcaagggt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2686344 tgtcttcgatgtttttgtaccatatggctaagtaaatgttgttggaatttgttccggggatgaaaccaagaacaaatgtttggttgggtgattcaagggt 2686443  T
215 ctgatttgtgaatagtatttgtgatgaggttaaggtgtctgtgat 259  Q
    ||||||||| ||||| |||||||||||||||||||||||||||||    
2686444 ctgatttgtcaatagaatttgtgatgaggttaaggtgtctgtgat 2686488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University