View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_high_45 (Length: 242)
Name: NF9779_high_45
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_high_45 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 41676509 - 41676736
Alignment:
| Q |
19 |
acagagcagaacaaatttaagttcatatatcctaattatgaacgtatagttttaatttgcatcaaaatatgaaagaggttttgaaaagtataataaagag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
41676509 |
acagagcagaacaaatttaagttcatatatcctaattatgaacgtatagttttaatttgcatcaaaatatgaaagaggtgttgataagtataataaagaa |
41676608 |
T |
 |
| Q |
119 |
acattgagttcaatttttgctattcgaatttaatta----attatatgtagatatgcagataatcctaaaaatgttaatcgtgcttaacgagtcgggcag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41676609 |
acattgagttcaatttttgctattcgaatttaattaatttattatctgtagatatgcagataatcctaaaaatgttaatcgtgcttaacgagtcgggcag |
41676708 |
T |
 |
| Q |
215 |
ggagcctaaaactcaagaggttcatcac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41676709 |
ggagcctaaaactcaagaggttcatcac |
41676736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University