View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_low_17 (Length: 412)
Name: NF9779_low_17
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 18 - 391
Target Start/End: Original strand, 43450146 - 43450519
Alignment:
| Q |
18 |
agtgtgagcagtgatcaagcgttaaagctgaaggagttggagaaggagtacgaaaaggttttggatgagaattgcagggttcttgctgtgtattttaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43450146 |
agtgtgagcagtgatcaagcgttaaagctgaaggagttggagaaggagtacgaagaggttttggatgagaattgcagggttcttgctgtgtattttaaag |
43450245 |
T |
|
| Q |
118 |
aggttttggtgaataaagatgaagattcgacaattagtccaccgttgttgatcttgaagaacgctgcaggaagtggcagcaacgacggtggtggattgca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43450246 |
aggttttggtgaataaagatgaagattcgacgattagtccaccgttgttgatcttgaagaacgctgcaggaagtggcagcaacgaccgtggtggattgca |
43450345 |
T |
|
| Q |
218 |
tagaaaggaggaaatgaaaatgcctcagttggagaacggacggtataatgtaatgttgtccttgatgttatttgtttacgaatttatacttttcttcaat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43450346 |
tagaaaggaggaaatgaaaatgcctcagttggagaacggacggtataatgtaatgttgtccttgatgttatttgtttacgaatttatacttttcttcaat |
43450445 |
T |
|
| Q |
318 |
tcaacttacaaatgtttatgtttgttgtgttaatttcattgggttcgttcaattttttatcaactgggatttta |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43450446 |
tcaacttacaaatgtttatgtttgttgtgttaatttcattgggttcgttcaattttttatcaactgggatttta |
43450519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University