View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_low_31 (Length: 349)
Name: NF9779_low_31
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_low_31 |
 | |
|
| [»] scaffold0068 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 9e-61; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 119 - 258
Target Start/End: Complemental strand, 13878736 - 13878601
Alignment:
| Q |
119 |
ttgttgtgaatatattgcttatttaaaactacaattcctgaaagtctgaaacgtcggtaccgagagataagggaaaaacgatccctttgaaaagatcaac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13878736 |
ttgttgtgaatatattgcttatttaaaactacaattcctgaaagtctgaaaggtcggtaccgagagataagggaaaaacgatccctttgaaaagatcaac |
13878637 |
T |
|
| Q |
219 |
accgagagaggaggattaattaatttgtttctgaaataat |
258 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13878636 |
accgagagaggaggatt----aatttgtttctgaaataat |
13878601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 21 - 124
Target Start/End: Complemental strand, 13878864 - 13878761
Alignment:
| Q |
21 |
acaatatgatgatgagcgtaacaaatttatcgagtcgatacctaatttctggtaactttattcaatgttgagtatttgtgttcttctttaaatatttttt |
120 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13878864 |
acaatatgatgatgggcgtaacaaatttatcgagtcgatacctaatttctggtaactttattcaatgttgagtatttatgttcttctttaaatatttttt |
13878765 |
T |
|
| Q |
121 |
gttg |
124 |
Q |
| |
|
|||| |
|
|
| T |
13878764 |
gttg |
13878761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 239
Target Start/End: Original strand, 19071231 - 19071306
Alignment:
| Q |
165 |
tgaaacgtcggtaccgagagataagggaaaaacgat-ccctttgaaaagatcaacaccgagagaggaggattaatt |
239 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||| |||||||||||||||| |||| ||||| |||| |||||| |
|
|
| T |
19071231 |
tgaaaggtaggtaccgagagataagggaaaaatgatcccctttgaaaagatcaccaccaagagacgagggttaatt |
19071306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 239
Target Start/End: Original strand, 19119121 - 19119196
Alignment:
| Q |
165 |
tgaaacgtcggtaccgagagataagggaaaaacgat-ccctttgaaaagatcaacaccgagagaggaggattaatt |
239 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||| |||||||||||||||| |||| ||||| |||| |||||| |
|
|
| T |
19119121 |
tgaaaggtaggtaccgagagataagggaaaaatgatcccctttgaaaagatcaccaccaagagacgagggttaatt |
19119196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 332
Target Start/End: Complemental strand, 13878601 - 13878548
Alignment:
| Q |
282 |
tgtttctctgtgcagaagaa---agataatgagtggaattctaggggtagattt |
332 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
13878601 |
tgtttctctgtgcagaagaagaaagataatgagtggaattctagggggagattt |
13878548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 239
Target Start/End: Original strand, 58771 - 58846
Alignment:
| Q |
165 |
tgaaacgtcggtaccgagagataagggaaaaacgat-ccctttgaaaagatcaacaccgagagaggaggattaatt |
239 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||| |||||||||||||||| |||| ||||| |||| |||||| |
|
|
| T |
58771 |
tgaaaggtaggtaccgagagataagggaaaaatgatcccctttgaaaagatcaccaccaagagacgagggttaatt |
58846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 174 - 239
Target Start/End: Complemental strand, 21803160 - 21803094
Alignment:
| Q |
174 |
ggtaccgagagataagggaaaaacgat-ccctttgaaaagatcaacaccgagagaggaggattaatt |
239 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||| |||| ||||| |||| |||||| |
|
|
| T |
21803160 |
ggtaccgagagataagggaaaaacaatcccctttgaaaagatcaccaccaagagacgagggttaatt |
21803094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University