View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_low_55 (Length: 270)
Name: NF9779_low_55
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 9470470 - 9470238
Alignment:
| Q |
1 |
ttagaatttgtttctgcttaaatttaattctttgtcagtgtaannnnnnnatgctatcaagcaatcacaatcaatcctatatctaaaatttaacatcact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9470470 |
ttagaatttgtttctgcttaaatttaattctttgtcagtgtaatttttttatgctatcaagcaatcacaatcaatcctatatctaaaatttaacatcact |
9470371 |
T |
 |
| Q |
101 |
acannnnnnnctttgaaaatgctaacttgtgattatccatgtcaagctatgatattaattaaacaaattaattgtcttttagttattcaaatagaaaatt |
200 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9470370 |
acatttttttctttggaaatgctaacttgtgattatccatgtcaagctatgatattaattaaacaaattaattgtcttttagttattcaaatagaaactt |
9470271 |
T |
 |
| Q |
201 |
cattatcaagataatcataattgtaatgtttta |
233 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
9470270 |
cattatcaagattatcataattgtaatgtttta |
9470238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University