View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_low_56 (Length: 267)
Name: NF9779_low_56
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 5014804 - 5014558
Alignment:
| Q |
18 |
gccacaatttagaaccatgtttggatgtatgtgttcatgagtttctctctagtggtttcatgattgatgatcatgtgttaatgtaaaaaacttggtatgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5014804 |
gccacaatttagaaccatgtttggatgtatgtgttcatgagtttctctctagtggtttcatgattgatgatcatgtgttaatgtaaaaaacttggtatgc |
5014705 |
T |
|
| Q |
118 |
attatgtatgttgtttcttagatggtgttaacgtgttcaaagggattgta--------attcatgtagttgttggagtgtccttttgatcagaaaggaac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5014704 |
attatgtatgttgtttcttagatggtgtt-acgtattcaaagggattgtaatagtgatattcatgtagttgttggagtgtccttttgatcagaaaggaac |
5014606 |
T |
|
| Q |
210 |
tcactaactgtccttacgaagtttgcttgattcaaactcatgtctctg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5014605 |
tcactaactgtccttacgaagtttgcttgattcaaactcatgtctctg |
5014558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University