View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9779_low_64 (Length: 249)

Name: NF9779_low_64
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9779_low_64
NF9779_low_64
[»] chr5 (1 HSPs)
chr5 (1-237)||(26210077-26210313)


Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 26210077 - 26210313
Alignment:
1 agtctttggttacggacttgttgctctcgttgtcgcgcgtgcgaatagtgcttattctagcaagttgtaaagaatttcgcgctgattctatttgaagctt 100  Q
    |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26210077 agtctttggttatggacttgttgctcttgttgtcgcgcgtgcgaatagtgcttattctagcaagttgtaaagaatttcgcgctgattctatttgaagctt 26210176  T
101 gacatcatcatccgtattatggttttgttcaacccttttaagggttgaactagcaccagaggatgatgatgtcgagcttcttgcagtagcatctgaacta 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26210177 gacatcatcatctgtattatggttttgttcaacccttttaagggttgaactagcaccagaggatgatgatgtcgagcttcttgcagtagcatctgaacta 26210276  T
201 cgcttccgattttcattggagattttttgtggaacct 237  Q
    |||||||||||||||||||| ||||||||||||||||    
26210277 cgcttccgattttcattggaaattttttgtggaacct 26210313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University