View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_low_65 (Length: 244)
Name: NF9779_low_65
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_low_65 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 3378033 - 3377851
Alignment:
| Q |
16 |
gattttgcaagaaatgaaattgaatacaagccttctgtttcatgaatgaatgaaaataaaagcatacactatgcactcattgtgcataaggactaatcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3378033 |
gattttgcaagaaatgaaattgaatacaagccttctgtttcatgaatgaatgaaaataaaagcatacactatgcactcattgtgcataaggactaatcat |
3377934 |
T |
|
| Q |
116 |
acacaattc-ctcacccttctatatccttcatcttctc--ttatatgatcaaccaactagaaaattaactatacaacaacaat |
195 |
Q |
| |
|
|||| || | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3377933 |
acactatgcactcacccttctatatccttcatcttctcttttatatgatcaaccaactagaaaattaactatacaacaacaat |
3377851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 3377833 - 3377799
Alignment:
| Q |
207 |
ctaattataaacaaaatacgtagaacaccaaactc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
3377833 |
ctaattataaacaaaatacgtagaacacaaaactc |
3377799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University