View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_low_66 (Length: 242)
Name: NF9779_low_66
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_low_66 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 4120851 - 4121076
Alignment:
| Q |
18 |
caaccacacgtgagcagagcaacgtgggaccatatttagagttttaggccgtaagataatgaaactgattaatctaataattgaaaattaaaactatagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
4120851 |
caaccacacgtgagcagagcaacgtgggaccatatttagagttttaggccgtaagataatgaaactgattaaactaataattgaaaattaaaactagagc |
4120950 |
T |
 |
| Q |
118 |
attacatttacacctacccatggctgctcttaga-nnnnnnncatgaaccagatatcctctacatgcaacacagcaaccgtagagattcaatagcaggcg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4120951 |
attacatttacacctacccatggctgctcttatattttttttcatgaaccggatatcctctacatgcaacacagcaacagtagagattcaatagcaggcg |
4121050 |
T |
 |
| Q |
217 |
cagcaaagctatccctcaagagattt |
242 |
Q |
| |
|
|||||||| ||||||||||||||||| |
|
|
| T |
4121051 |
cagcaaagttatccctcaagagattt |
4121076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University