View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_low_71 (Length: 239)
Name: NF9779_low_71
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_low_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 37141455 - 37141673
Alignment:
| Q |
1 |
gaacagattcctaacaaactcaagcaccatatgatagcacttgtattgataccagaaaaccaaatactatctagaaatgtagcatatttccatatttttg |
100 |
Q |
| |
|
|||||||||| ||||||||| || || |||||||||||||||||||||||||||||| ||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
37141455 |
gaacagattcttaacaaacttaaacattatatgatagcacttgtattgataccagaaa-ccaaacactatcttgaaatgtggcatatttccatatttttg |
37141553 |
T |
|
| Q |
101 |
ggataaacaatgtggcattgctgaaatttttccctagatatgttgcttgacttgacattccttttgttttcatggggtgtattgccccatttcttagaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37141554 |
ggataaacaatgtggcattgctgaaatttttcc-tagatatgttgcttaagttgacattccttttgttttcatggggtgtattgctccatttcttagaat |
37141652 |
T |
|
| Q |
201 |
tctagtctttgagaggatatg |
221 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
37141653 |
tctagtatttgagaggatatg |
37141673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University