View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_low_78 (Length: 232)
Name: NF9779_low_78
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_low_78 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 2665344 - 2665123
Alignment:
| Q |
11 |
cataggctcaattgcaagagacttaaaagtgaacagccatcaatcttctagagatgtaagcggggcgcagtggcaatgatgagtaagaaggagcagctac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665344 |
cataggctcaattgcaagagacttaaaagtgaacagccatcaatcttctagagatgtaagtggggcgcagtggcaatgatgagtaagaaggagcagctac |
2665245 |
T |
|
| Q |
111 |
atccaatggggggaatgttggaataaccggaggctcaacaggggcaacaataggggcagaagggtctacagggggctcaacaggtgcaggcgtagcaggg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665244 |
atccaatggggggaatgttggaataaccggaggctcaacaggggcaataataggggcagaagggtctacagggggctcaacaggtgcaggcgtagcaggg |
2665145 |
T |
|
| Q |
211 |
acaagggggataattggggaaa |
232 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2665144 |
acaagggggataattggggaaa |
2665123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University