View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9779_low_86 (Length: 222)
Name: NF9779_low_86
Description: NF9779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9779_low_86 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 27 - 198
Target Start/End: Original strand, 51507559 - 51507730
Alignment:
| Q |
27 |
gagagagaagaagacactgaatacgatcgaataacatgacaaaaattgcagtgtattcagaatggccaataagaaattatgagtgagacacctagatttt |
126 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51507559 |
gagacagaagaagacactgaatacgattgaataacatgacaaaaattgcagtgtattcagaatggccaataagaaattatgagtgagacacctagatttt |
51507658 |
T |
|
| Q |
127 |
cttatcgtgactttcataggtatctagaatttcctattatcatgtattccttcaggtatggggagccgtacg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51507659 |
cttatcgtgactttcataggtatctagaatttcctattatcatgtattccttcaggtatggggagctgtacg |
51507730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University