View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9780_high_15 (Length: 244)
Name: NF9780_high_15
Description: NF9780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9780_high_15 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 43102192 - 43102432
Alignment:
| Q |
1 |
cataaatgaatgaagtagtttgaattagaatcccgatagaagcaatggttacggtggggtccacaagtaaaccacataaaatgatcattacttcatacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102192 |
cataaatgaatgaagtagtttgaattagaatcccgatagaagcaatggtaacggtggggtccacaagtaaaccacataaaatgatcattacttcatacca |
43102291 |
T |
|
| Q |
101 |
ccaccattccaaacaaacggaaacgcagcttggcgtggcaagtcggagtaaaggcttccagccggtgagacactcctggcttggtgctgtccaagttgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43102292 |
ccaccattccaaacaaacggaaacgcagcttggcgtggcaagtcggagtaaaggcttccagccggtgagacactcctgacttggtgctgtccaagttgtg |
43102391 |
T |
|
| Q |
201 |
cggtgtaagcccgttaaccaaacataagcgatgaggaacaa |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102392 |
cggtgtaagcccgttaaccaaacataagcgatgaggaacaa |
43102432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 133
Target Start/End: Complemental strand, 24282 - 24241
Alignment:
| Q |
92 |
ttcataccaccaccattccaaacaaacggaaacgcagcttgg |
133 |
Q |
| |
|
||||||||||||||||||||| || || |||||||||||||| |
|
|
| T |
24282 |
ttcataccaccaccattccaagcagacagaaacgcagcttgg |
24241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 124
Target Start/End: Complemental strand, 51875031 - 51874979
Alignment:
| Q |
72 |
ccacataaaatgatcattacttcataccaccaccattccaaacaaacggaaac |
124 |
Q |
| |
|
||||| ||||| ||||| | |||||||||||||||||| |||||||| ||||| |
|
|
| T |
51875031 |
ccacacaaaattatcatgagttcataccaccaccattctaaacaaacagaaac |
51874979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University