View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9780_low_17 (Length: 268)
Name: NF9780_low_17
Description: NF9780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9780_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 4594048 - 4593808
Alignment:
| Q |
17 |
ataaacacacttttcttttgttcgagagaaactcaaacacttcttcaggtatgttacattcaaattccttaaattctgttttctttctctttttgattag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4594048 |
ataaacacacttttcttttgttcgagagaaactcaaacacttcttcaggtatgttacattcaaattccttaaattctgttttctttctctttttgattag |
4593949 |
T |
 |
| Q |
117 |
ttctcatgcttttgctcttgttcttatcacacacttgttagaattattgtattaattattatacttggttttgttatatagattatatannnnnnnnnng |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4593948 |
ttctcatgcttttgctcttgttcttatcacgcacttgttagaattattgtattaattattatacttggttttgttatatagattatatatattttttttg |
4593849 |
T |
 |
| Q |
217 |
ttatgaatattatgtatgatatgctatgattattatgatgt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4593848 |
ttatgaatattatgtatgatatgctatgattattatgatgt |
4593808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 45 - 158
Target Start/End: Complemental strand, 4587112 - 4586999
Alignment:
| Q |
45 |
aaactcaaacacttcttcaggtatgttacattcaaattccttaaattctgttttctttctctttttgattagttctcatgcttttgctcttgttcttatc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||| |||||| ||||| | ||||||||||| ||||| |
|
|
| T |
4587112 |
aaactcaaacacttcttcaggtatgttacattcaaatttcttcaattctgttttctttgtcttttttattagtattcatgttcttgctcttgtttttatc |
4587013 |
T |
 |
| Q |
145 |
acacacttgttaga |
158 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
4587012 |
acacactttttaga |
4586999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 45 - 166
Target Start/End: Complemental strand, 4538213 - 4538093
Alignment:
| Q |
45 |
aaactcaaacacttcttcaggtatgttacattcaaattccttaaattctgttttctttctctttttgattagttctcatgcttttgctcttgttcttatc |
144 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| ||| |||| |||||||||| | ||||| |||||| || ||| |||||||||| ||| |||| |
|
|
| T |
4538213 |
aaactcaaacgcttcttcag-tatgttacattcaaatttcttcaattatgttttctttgttttttttattagtactaatgtttttgctcttattcgtatc |
4538115 |
T |
 |
| Q |
145 |
acacacttgttagaattattgt |
166 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
4538114 |
acacacttgttagaatttttgt |
4538093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 134 - 204
Target Start/End: Complemental strand, 4602378 - 4602308
Alignment:
| Q |
134 |
ttgttcttatcacacacttgttagaattattgtattaattattatacttggttttgttatatagattatat |
204 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
4602378 |
ttgttattatcacacacttgttagaattaatgtattaattcttatacttgtttttgttatatagattatat |
4602308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University