View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9780_low_20 (Length: 239)
Name: NF9780_low_20
Description: NF9780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9780_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 9083755 - 9083977
Alignment:
| Q |
1 |
tatgcaagatgttgaaaccatgacaataaacccaaatctaacaactttgtggtcgtactatactttttgcatgatatatcaagtgatctttaagggtatt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9083755 |
tatgcaagatcttgaaaccatgacaataaacccaaatctgacaactttgtggtcgtaatatactttttgcatgatatatcaagtgatctttaagggtact |
9083854 |
T |
 |
| Q |
101 |
atcactatgaatgtttcggtgaggaaaaataaaacaaggaatnnnnnnnnttgtacgagttagtcacgtcttcatgcgcgatgcacactagaaactgctc |
200 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9083855 |
gtcactatgaacgtttcggtgaagagaaataaaacaaggaataaaaaaaattgtacgagttagtcacgtcttcatgcgcgatgcacactagaagctgctc |
9083954 |
T |
 |
| Q |
201 |
atgtgcaacttgggagaaaatga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9083955 |
atgtgcaacttgggagaaaatga |
9083977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 89
Target Start/End: Original strand, 18091344 - 18091387
Alignment:
| Q |
46 |
tttgtggtcgtactatactttttgcatgatatatcaagtgatct |
89 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||| |
|
|
| T |
18091344 |
tttgtggtcgtactatacttattacatgatgtatcaagtgatct |
18091387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 27602850 - 27602886
Alignment:
| Q |
30 |
acccaaatctaacaactttgtggtcgtactatacttt |
66 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27602850 |
acccaaatcagacaactttgtggtcgtactatacttt |
27602886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University