View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9781_high_6 (Length: 307)
Name: NF9781_high_6
Description: NF9781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9781_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 134 - 301
Target Start/End: Original strand, 50253240 - 50253407
Alignment:
| Q |
134 |
atatttatgtcatcaacaaattgttgacatcgaattttatcactccaacaaataagctcgacgatcaatctatgacaaaatttagatgccagttgaattc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
50253240 |
atatttatgtcatcaacaaattgttgacatcgaattttatcactccaacaaataagctcgacgatcaatctatgacaaaatttagatcctagttgaattc |
50253339 |
T |
 |
| Q |
234 |
ttagttgataggttcaaagtcacacgtcttaattttcgaaacaagaaacatgcatttgaattataaac |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50253340 |
ttagttgataggttcaaagtcacacgtcttaattttcgaaacaagaaacatgcattcgaattataaac |
50253407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University