View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9781_high_7 (Length: 288)
Name: NF9781_high_7
Description: NF9781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9781_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 122 - 282
Target Start/End: Original strand, 30625305 - 30625465
Alignment:
| Q |
122 |
gtattgtagtgctagtggttataataggaaaatagagatgcacgggttttgcatattgtgcccctatgagaggacaacaacccttgtcttgcgggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30625305 |
gtattttagtgctagtggttataataggaaaatagagatgcacgggttttgcatattgtgcccctatgagaggacaacaacccttgtcttgcgggtttta |
30625404 |
T |
 |
| Q |
222 |
tatttcatactcaaaagtttgtgaagagacaaattggacctaaatctaactcctatgcttc |
282 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30625405 |
tatttcatcctcaaaagtttgtgaagagacaaattggacctaaatctaactcctatgcttc |
30625465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 30625205 - 30625244
Alignment:
| Q |
18 |
aattttaggttttattaaggttgaaactattagttgaaag |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30625205 |
aattttaggttttattaaggttgaaactattagttgaaag |
30625244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University