View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9781_low_7 (Length: 293)
Name: NF9781_low_7
Description: NF9781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9781_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 8 - 278
Target Start/End: Original strand, 37574534 - 37574808
Alignment:
| Q |
8 |
cacgtaggggtagctagatt----aatctgatgatgcatgaggatgaggccaatacaaccaaatttactatacaataccctctctctcttccatgcatgc |
103 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37574534 |
cacgtaggggtagctagagtgatgaatttgatgatgcatgaggatgaggccaatacaaccaaatttacaatacaataccctctctctcttccatgcatgc |
37574633 |
T |
 |
| Q |
104 |
atgatgcatccatataccatacaaccttggtaagtagtactatagctagttaataccgtttgtatttatctggagtactataccataaccacctgcaatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37574634 |
atgatgcatccatataccatacaaccttggtaagtagtactatagctagttaataccgtttgtatttatctggagtactataccataaccacctgcaatt |
37574733 |
T |
 |
| Q |
204 |
ataaatcactactgcctcatatgttttttgttctagtgcactgcacatattaatattaattaccactaccatttc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37574734 |
ataaatcactactgcctcatatgttttttgttctactgcactgcacatattaatattaattaccactaccatttc |
37574808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University