View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_high_22 (Length: 249)
Name: NF9782A_high_22
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 34 - 197
Target Start/End: Original strand, 9457146 - 9457309
Alignment:
| Q |
34 |
tgtttactttatagatgatcattagattgtaataaaaatcacatatagccattttggaatacggtaataaaaatctcaacactcattttgttaccgatct |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457146 |
tgtttactttatagatgatcattagattgtaataaaaatcacatatagccgttttggaatacggtaataaaaatctcaacactcattttgttaccgatct |
9457245 |
T |
 |
| Q |
134 |
caagtttgtgttttgtgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
197 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457246 |
caagtttgtgttttgcgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
9457309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 240
Target Start/End: Original strand, 9458329 - 9458376
Alignment:
| Q |
193 |
ttttcgcaattcctctttcagttccttttggattttgtttatattctt |
240 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
9458329 |
ttttcacaattcctctttcaattccttttggattttgtttatgttctt |
9458376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University