View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_high_29 (Length: 222)
Name: NF9782A_high_29
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 23 - 197
Target Start/End: Original strand, 37085 - 37259
Alignment:
| Q |
23 |
aagatttctttgcaagatgttgaatttggtgaagatcaagaattaagccatgatgataaaatttgatgaaatgagtgcatatagttatgacacacattgc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37085 |
aagatttctttgcaagatgttgaatttggtgaagatcaagaattaagccatgatgataaaatttgatgaaatgagtgcatatagttatgacacacatttc |
37184 |
T |
 |
| Q |
123 |
tttatttgcatcttttgtctagttaaaatggtagtaaaagttggtatgcatctgcttgcacttgcacatattcat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37185 |
tttatttgcatcttttgtctagttaaaatggtagtaaaacttggtatgcatctgcttgcacttgcacatattcat |
37259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University