View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_106 (Length: 222)
Name: NF9782A_low_106
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_106 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 2 - 191
Target Start/End: Original strand, 33025806 - 33025995
Alignment:
| Q |
2 |
catgattgagtcgtggtccagaggtgtgaggtatgatggaaaatccgatgatatcgcaaaggatttgttaaaaggtgctcttgatttgcaagagtctcta |
101 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33025806 |
catgattgagtcgtggtctagaggtgtgaggtacgatggaaaatccgatgatatcgcaaaggatttgttaaaaggtgctcttgatttgcaagagtctcta |
33025905 |
T |
|
| Q |
102 |
gagatgcttcgaaaggtgcaggaagcttcgaatagtatgggtcgatcgaagagaagacaagaggagaaacatgaaagaagtaaaattgat |
191 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33025906 |
gagatgcttcgacaggtgcaagaagcttcgaatagtatgagtcgatcgaagagaagacaagaggagaaacatgaaagaagtaaaattgat |
33025995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 33026041 - 33026002
Alignment:
| Q |
183 |
aaaattgattagaatgtgttgatctatttccatcattcac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026041 |
aaaattgattagaatgtgttgatctatttccatcattcac |
33026002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University