View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_108 (Length: 222)
Name: NF9782A_low_108
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_108 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 39480654 - 39480433
Alignment:
| Q |
1 |
tcagagacggtgtggacgttctatccttgtctctaggcggtttcccggtgccactatatgatgatagtattgccattggaagctttcgagcaatggagaa |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480654 |
tcagagatggtgtggacgttctatccttgtctctaggtggtttcccggtgccactatatgatgatagtattgccattggaagctttcgagcaatggagaa |
39480555 |
T |
|
| Q |
101 |
agggatttcagttatatgtgcggcaggaaacaatggcccaatggcgatgtctgttgccaatgatgctccttggattgcaactattggagcaagcacactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480554 |
agggatttcagttatatgtgcggcaggaaacaatggcccaatggcgatgtctgttgccaatgatgctccttggattgcaactattggagcaagcacactt |
39480455 |
T |
|
| Q |
201 |
gacagaaaattccccgctatag |
222 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
39480454 |
gacagaaaattcccagctatag |
39480433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University