View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_114 (Length: 215)
Name: NF9782A_low_114
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_114 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 32472894 - 32473071
Alignment:
| Q |
19 |
cggcgaagtggagttcatacatggcggggatgttgggagcgatgacggagacgacgttgccgcggcggatacctaaggaggtgatggcggaggcaagttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32472894 |
cggcgaagtggagttcatacatggcggggatgttgggagcgatgacggagacgacgttgccgcggcggatacctaaggaggtgatggcggaggcaagttg |
32472993 |
T |
 |
| Q |
119 |
gaggcatcgtttgtgggtttgagaccatgtgaaaacggtgtcgttgtagatgatggaaggtgtgttggggtagattgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32472994 |
gaggcatcgtttgtgggtttgagaccatgtgaaaacggtgtcgttgtagatgatggaaggtgtgttggggtagattgt |
32473071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University