View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9782A_low_114 (Length: 215)

Name: NF9782A_low_114
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9782A_low_114
NF9782A_low_114
[»] chr5 (1 HSPs)
chr5 (19-196)||(32472894-32473071)


Alignment Details
Target: chr5 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 32472894 - 32473071
Alignment:
19 cggcgaagtggagttcatacatggcggggatgttgggagcgatgacggagacgacgttgccgcggcggatacctaaggaggtgatggcggaggcaagttg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32472894 cggcgaagtggagttcatacatggcggggatgttgggagcgatgacggagacgacgttgccgcggcggatacctaaggaggtgatggcggaggcaagttg 32472993  T
119 gaggcatcgtttgtgggtttgagaccatgtgaaaacggtgtcgttgtagatgatggaaggtgtgttggggtagattgt 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32472994 gaggcatcgtttgtgggtttgagaccatgtgaaaacggtgtcgttgtagatgatggaaggtgtgttggggtagattgt 32473071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University