View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_123 (Length: 208)
Name: NF9782A_low_123
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_123 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 183
Target Start/End: Original strand, 885531 - 885691
Alignment:
| Q |
23 |
ttatgtacattaacaaaatgtaagatgaactagattttccccttttattaggccttgaaatgcataatccatatattccacatatagtaatagaaatact |
122 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
885531 |
ttatgtacattaacaaaatgaaagatgaactagattttccccttttattaggccttgaaatgcataatccatatattccacatatagtaatagaaatact |
885630 |
T |
|
| Q |
123 |
agttaacaaaaggtagaagcaattaatgcattcctacaaactctccctctccaactcattc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
885631 |
agttaacaaaaggtagaagcaattaatgcattcctacaaactctccctctccaactcattc |
885691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 90
Target Start/End: Original strand, 1849107 - 1849159
Alignment:
| Q |
39 |
aatgtaagatgaactagattttc-cccttttattaggccttgaaatgcataat |
90 |
Q |
| |
|
|||| |||||||||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
1849107 |
aatgaaagatgaactagtttttttcccttatattaggccttgaaatgcataat |
1849159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University