View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_128 (Length: 203)
Name: NF9782A_low_128
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_128 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 114 - 186
Target Start/End: Complemental strand, 10368546 - 10368474
Alignment:
| Q |
114 |
cacaagtttggtgacatttatataggctctttgtagatgacatattagatcaatcaatccgttgaattgaaag |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10368546 |
cacaagtttggtgacatttatataggctctttgtagatgacatattaaatcaatcaatccgttgaattgaaag |
10368474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 52
Target Start/End: Complemental strand, 10368636 - 10368608
Alignment:
| Q |
24 |
tggagttcaaagattcagatttgttttct |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10368636 |
tggagttcaaagattcagatttgttttct |
10368608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University