View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_27 (Length: 320)
Name: NF9782A_low_27
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_27 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 7 - 320
Target Start/End: Original strand, 30693132 - 30693445
Alignment:
| Q |
7 |
aaaaggagatcatgcaattgtccatgaacatcgccaacaaccacaacggaagccgaagaatcgggctcgggacgaaagggttgaatagggacgcaattag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30693132 |
aaaaggagatcatgcaattgtccatgaacatcgccaacaaccacaacggaagccgaagaatcgggctcgggacgaaagggttgaatagggacgcaattag |
30693231 |
T |
|
| Q |
107 |
gttctttgtgaagcatcttggaggcgatgaggatgagagaatcgaagacatgaacggggagaatggatgggaattcggaagcagggagattcttggaaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30693232 |
gttctttgtgaagcatcttggaggcgatgaggatgagagaatcgaagacatgaacggggagaatggatgggaattcggaagcagggagattcttggaaga |
30693331 |
T |
|
| Q |
207 |
ccaatcgaaggcgagggttaggttttggatccattcgatggttagttttgcgtcttctggccaggatatcgggagttggagttctggtggtggcggtgag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
30693332 |
ccaatcgaaggcgagggttaggttttggatccattcgatggttagttttgcgtcttctggccaggatatcgggagttggagttctggtggtggtgatgag |
30693431 |
T |
|
| Q |
307 |
gaggaagatgattg |
320 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30693432 |
gaggaagatgattg |
30693445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University