View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_39 (Length: 291)
Name: NF9782A_low_39
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_39 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 180 - 291
Target Start/End: Complemental strand, 12844663 - 12844552
Alignment:
| Q |
180 |
ttcttcttttccctttcttcaaagcataagtccaactcaaaataaaagcatcaataaaatctatcaagataaatcttcaacatgctcatcaccactactt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
12844663 |
ttcttcttttccctttcttcaaagcataagtccaactcaaaataaaagcatcaataaaatctatcaagataaatattcaacatgctcatcaccacttttt |
12844564 |
T |
|
| Q |
280 |
tgtattcttttt |
291 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12844563 |
tgtattcttttt |
12844552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 47 - 109
Target Start/End: Complemental strand, 12844799 - 12844734
Alignment:
| Q |
47 |
aaaacttgcttcatctctcattcttcaaaacatagaac---agtacatgatccaactcacaaaatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12844799 |
aaaacttgcttcatctctcattcttcaaaacatagaacagtagtacatgatccaactcacaaaatg |
12844734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University