View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_43 (Length: 279)
Name: NF9782A_low_43
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 9 - 273
Target Start/End: Original strand, 32528225 - 32528489
Alignment:
| Q |
9 |
aatgagatgaaacaaacaaccgaagatgacactttctagtactaccaaaactgtctcttagctacttttagtactnnnnnnnntgatttagagagagaaa |
108 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32528225 |
aatgaaatgaaacaaacaacctaagatgacactttctagtactaccaaaactgtctcttagctacttttagtactaaaaaaaatgatttagagagagaaa |
32528324 |
T |
 |
| Q |
109 |
tgtgatctacacaaaagacttgaactacatcttaggattgagtgtgacagaaagaaagttaatatgagagtaactctaggaacaaaataaggagagtgga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528325 |
tgtgatctacacaaaagacttgaactacatcttaggattgagtgtgacagaaagaaagttaatatgagagtaactctaggaacaaaataaggagagtgga |
32528424 |
T |
 |
| Q |
209 |
gcgagaactttggcgaaaaatgagtgaatattactctcattcatagttactttagatttgcttgc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528425 |
gcgagaactttggcgaaaaatgagtgaatattactctcattcatagttactttagatttgcttgc |
32528489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University