View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_46 (Length: 271)
Name: NF9782A_low_46
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 29442587 - 29442464
Alignment:
| Q |
1 |
gaggattccggtaagtatctccggcggaagatccgccattggaaggaaggaaggaaggttctagttagggt-------ttagggtttttcctttcttcct |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29442587 |
gaggattccggtaagtatctccggcggaagatccaccattggaaggaagg----aaggttctagttagggtttaggccttagggtttttcctttcttcct |
29442492 |
T |
|
| Q |
94 |
ctccatgtacgacccaaatgcaacacag |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
29442491 |
ctccttgtacgacccaaatgcaacacag |
29442464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 193 - 271
Target Start/End: Complemental strand, 29442391 - 29442313
Alignment:
| Q |
193 |
cttgattacgtgatcttggacgcacgaattatgaattactctgagttaatatccttcatttatgattctctctgtttta |
271 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29442391 |
cttgattacatgatcttggacgcacgaattatgaattactctgagttaatatccttcatttatgattctctctgtttta |
29442313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 29424135 - 29424226
Alignment:
| Q |
1 |
gaggattccggtaagtatctccggcggaagatccgccattggaaggaaggaaggaaggttctagttagggtttagggtttttcctttcttcct |
93 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||| || ||||| ||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
29424135 |
gaggattccggtgagtatctccggcggaagatccgtcattgg-agcttggaagttaggttctagctagggtttagagtttttcatttcttcct |
29424226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 29452579 - 29452537
Alignment:
| Q |
1 |
gaggattccggtaagtatctccggcggaagatccgccattgga |
43 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29452579 |
gaggataccggtaagtatctccggcggaagatccgccattgga |
29452537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 41 - 78
Target Start/End: Complemental strand, 29452503 - 29452466
Alignment:
| Q |
41 |
ggaaggaaggaaggaaggttctagttagggtttagggt |
78 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
29452503 |
ggaaggaaggaaggaaggttgtagctagggtttagggt |
29452466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 33 - 90
Target Start/End: Original strand, 10354101 - 10354157
Alignment:
| Q |
33 |
ccgccattggaaggaaggaaggaaggttctagttagggtttagggtttttcctttctt |
90 |
Q |
| |
|
||||||||| |||||||||| ||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
10354101 |
ccgccattgtaaggaaggaatgaaggttct-gctagggtttagggtttttcatttctt |
10354157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 57
Target Start/End: Complemental strand, 9283399 - 9283343
Alignment:
| Q |
4 |
gattccggtaagtatctccggcggaagatc---cgccattggaaggaaggaaggaag |
57 |
Q |
| |
|
|||| ||| |||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9283399 |
gatttcggcaagtatgtccggcggaagatcggacgccattggaaggaaggaaggaag |
9283343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 10336751 - 10336785
Alignment:
| Q |
20 |
tccggcggaagatccgccattggaaggaaggaagg |
54 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
10336751 |
tccggcggaagatccgccattgtaaggaaggaagg |
10336785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University