View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_53 (Length: 259)
Name: NF9782A_low_53
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_53 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 8 - 254
Target Start/End: Complemental strand, 17435827 - 17435581
Alignment:
| Q |
8 |
tgaaatgaataatactgacacactcaattattttatgtcaaacaaagcctaactctgtcgtttccaggctctctttttgaggtacacagtctcttctaca |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17435827 |
tgaaatgaataataccgacacactcaattattttatgtcaaacaaagcctaactctgtcgtttccaggctctctttttgaggtacacaatctcttctaca |
17435728 |
T |
|
| Q |
108 |
tgctcttgtttcttgtattgctgagaatttcttcagttttacaattcatatgacgcaaaatttcaatttggtgtcagattttatattaatattctttcat |
207 |
Q |
| |
|
||||||||||| || ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17435727 |
tgctcttgtttgttatatagctgagaatttcttcagttttacaattcatatgacgcaaaatctcaatttggtgtcagattttatattaatatcctttcat |
17435628 |
T |
|
| Q |
208 |
atatccaatcttgatcatatacttgcatagtactcagcactttttgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17435627 |
atatccaatcttgatcatatacttgcatagtactcaacactttttgt |
17435581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 25 - 243
Target Start/End: Complemental strand, 17456885 - 17456657
Alignment:
| Q |
25 |
acacactcaattattttatgtcaaacaaagcctaactctgtcgtttccaggctctctttttgaggtacacagtctcttctacatgctcttgtttcttgta |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
17456885 |
acacactcaattattttatgtcaaacaaagcctaactctgtcgtttccaggctctctttttgaggtacacaatctcttctacatgcttttgtttcttgta |
17456786 |
T |
|
| Q |
125 |
ttgctgagaatttcttcagttttacaatt-----------catatgacgcaaaatttcaatttggtgtcagattttatattaatattctttcatatatcc |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| || |||| | |||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
17456785 |
ttgctgagaatttctccagttttacaattcatacccgtttcatatgatgcgaaatcttaatttgatgtcaaattttatatt-gttttctttcatatatcc |
17456687 |
T |
|
| Q |
214 |
aatcttgatcatatacttgcatagtactca |
243 |
Q |
| |
|
| | || ||||||||||||||||| ||||| |
|
|
| T |
17456686 |
attttttatcatatacttgcatagcactca |
17456657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University